Human evolution

Results: 3255



#Item
181

O R I G I NA L A RT I C L E doi:j01297.x EXPLORING POSSIBLE HUMAN INFLUENCES ON THE EVOLUTION OF DARWIN’S FINCHES ´ 1,2,3 Joost A.M. Raeymaekers,4 Eldredge Bermingham,2 Jeffrey Podos,5

Add to Reading List

Source URL: redpath-staff.mcgill.ca

Language: English - Date: 2012-08-23 14:33:22
    182Biology / Evolutionary biology / Genetics / Molecular evolution / Human genetics / Psychological stress / Mutation / Stress / Human skin color

    Yeast Adapts to a Changing Stressful Environment by Evolving Cross-Protection and Anticipatory Gene Regulation Riddhiman Dhar,1,2 Rudolf Sa¨gesser,1,2 Christian Weikert,1,2 and Andreas Wagner*,1,2,3 1 Institute of Evol

    Add to Reading List

    Source URL: www.ieu.uzh.ch

    Language: English - Date: 2015-12-07 07:40:25
    183Evolutionary computation / Evolutionary algorithms / Cybernetics / Evolution / Interactive evolutionary computation / Genetic algorithm / Neuroevolution of augmenting topologies / Swarm intelligence / Neuroevolution

    A Novel Human-Computer Collaboration: Combining Novelty Search with Interactive Evolution In: Proceedings of the 16th annual conference on Genetic and evolutionary computation, GECCO ’14, New York, NY. ACM Winner of th

    Add to Reading List

    Source URL: eplex.cs.ucf.edu

    Language: English - Date: 2014-07-23 13:53:35
    184

    Four Legs Good, Two Legs Fortuitous: Brains, Brawn, and the Evolution of Human Bipedalism DANIEL E. LIEBERMAN O

    Add to Reading List

    Source URL: www.fas.harvard.edu

    Language: English - Date: 2012-09-05 13:28:19
      185Genomics / Genome size / Genome / Ridge / Minimal genome / Gene / Rickettsia / Human genome / Organism / Overlapping gene / Genome evolution / Essential gene

      Genome Informatics 16(2): 69–Strategies for Genome Reduction in Microbial Genomes Kishore R. Sakharkar

      Add to Reading List

      Source URL: www.jsbi.org

      Language: English - Date: 2005-12-28 06:18:58
      186Biology / Genetics / Genomics / Molecular evolution / Molecular genetics / Genetic mapping / Mutation / Genome / Gene duplication / Human genome / Gene / Paleopolyploidy

      Genome Informatics 15(1): 229–Causes for the Large Genome Size in a Cyanobacterium Anabaena sp. PCC7120

      Add to Reading List

      Source URL: www.jsbi.org

      Language: English - Date: 2004-05-17 21:39:16
      187

      Evolution and Human Behavior–244 Costly signaling and torch fishing on Ifaluk atoll Richard Sosis* Department of Anthropology, U-2158, University of Connecticut, Storrs, CT, USA Manuscript rec

      Add to Reading List

      Source URL: www.anth.uconn.edu

      Language: English - Date: 2013-07-22 14:17:57
        188

        Evolution and Human Behavior – 143 Book review Darwin’s Cathedral: Evolution, Religion, and the Nature of Society By David Sloan Wilson, The University of Chicago Press, pp. ISBN: -

        Add to Reading List

        Source URL: www.anth.uconn.edu

        Language: English - Date: 2013-07-22 14:18:06
          189Biology / Genetics / Bioinformatics / Genomics / Genetic mapping / Human evolution / Human genetics / Human genome / Conserved sequence / Noncoding DNA / Genome / Comparative genomics

          GGTGCCAGGGAAAGGGCAGGAGGTGAGTGCTGGGAGGCAGCTGAGGTCAACTTCTTTTGAACTTCCACGTGGTATTTACTCAGAGCAATTGGTGCCAGAG GCTCAGGGCCCTGGAGTATAAAGCAGAATGTCTGCTCTCTGTGCCCAGACGTGAGCAGGTGAGCAGCTGGGGCGAAAGACCTGTTGGAGGCTATGAATGC AATCAAGGTGACAGACAA

          Add to Reading List

          Source URL: bejerano.stanford.edu

          Language: English - Date: 2009-04-17 16:28:41
          190

          A Comparison of Methods for Studying Elusive Savanna Chimpanzees at Ugalla, Tanzania Samantha M. Russak1,4, Fiona A. Stewart2,4, A. K. Piel3,4 1Institute of Human Origins, School of Human Evolution & Social Change, Ariz

          Add to Reading List

          Source URL: ugallaprimateproject.com

          Language: English
            UPDATE